Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circRNA_404686 | |||
Gene | n/a | Organism | Human |
Genome Locus | n/a | Build | hg19 |
Disease | Repeated implantation failure | ICD-10 | n/a (n/a) |
DBLink | Link to database | PMID | 29132137 |
Experimental Method | |||
Sample Type | Endometrial Tissues | Comparison | Three pairs of snap-frozen endometrial tissue with repeated implantation failure patients and control group |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward TCTCAGAACAAGAGCGTCCAT ReverseGTAGAGGGGCAACCGGTATT | Statistics | Fold Change : Downregulated pvalue : p<0.05 |
Citation | |||
Liu, L, Li, L, Ma, X, Yue, F, Wang, Y, Wang, L, Jin, P, Zhang, X (2017). Altered Circular RNA Expression in Patients with Repeated Implantation Failure. Cell. Physiol. Biochem., 44, 1:303-313. |